Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p35S_GFP-GUS
(Plasmid #167122)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167122 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pB7m34GW
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 11934
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-GUS
  • Alt name
    mGFP5
  • Alt name
    beta-glucuronidase
  • Insert Size (bp)
    2562
  • GenBank ID
  • Promoter CaMV 35S
  • Tag / Fusion Protein
    • mGFP5, GUS

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTCGACGGAGAAGGTGACGATAC
  • 3′ sequencing primer TTGGTGAAGATATCCGCCAACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p35S_GFP-GUS was a gift from Arturo Marí-Ordóñez & Olivier Voinnet (Addgene plasmid # 167122 ; http://n2t.net/addgene:167122 ; RRID:Addgene_167122)
  • For your References section:

    A genome-wide transcriptome and translatome analysis of Arabidopsis transposons identifies a unique and conserved genome expression strategy for Ty1/Copia retroelements. Oberlin S, Sarazin A, Chevalier C, Voinnet O, Mari-Ordonez A. Genome Res. 2017 Sep;27(9):1549-1562. doi: 10.1101/gr.220723.117. Epub 2017 Aug 7. 10.1101/gr.220723.117 PubMed 28784835