Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR1A-3xFlag-M694V-MEFV
(Plasmid #167118)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167118 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEntr1A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4710
  • Modifications to backbone
    removal of CddB-Cm resistance cassette. Introduction Kpn1-3xFlag-Not1-MEFVp.S242R-Xho1
  • Vector type
    gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MEFV
  • Alt name
    pyrin
  • Species
    H. sapiens (human)
  • Mutation
    M694V Methionine 694 to valine (FMF mutation)
  • Entrez Gene
    MEFV (a.k.a. FMF, MEF, PAAND, TRIM20)
  • Tag / Fusion Protein
    • 3xFlag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site xho1 (not destroyed)
  • 5′ sequencing primer TAGTTACTTAAGCTCGGGCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR1A-3xFlag-M694V-MEFV was a gift from Thomas Henry (Addgene plasmid # 167118 ; http://n2t.net/addgene:167118 ; RRID:Addgene_167118)
  • For your References section:

    Functional Assessment of Disease-Associated Pyrin Variants. Chirita D, Jamilloux Y, Henry T, Magnotti F. Methods Mol Biol. 2022;2523:179-195. doi: 10.1007/978-1-0716-2449-4_12. 10.1007/978-1-0716-2449-4_12 PubMed 35759198