pENTR1A-3xFlag-M694V-MEFV
(Plasmid #167118)

• Purpose: Gateway entry plasmid with 3xFlag-pyrin (M694V/FMF variant)
• Depositing Lab: Thomas Henry
• Publication: Chirita et al Methods Mol Biol. 2022;2523:179-195. doi: 10.1007/978-1-0716-2449-4_12.

Backbone

• Vector backbone: pEntr1A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 4710
• Modifications to backbone: removal of CddB-Cm resistance cassette. Introduction Kpn1-3xFlag-Not1-MEFVp.S242R-Xho1
• Vector type: gateway entry vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MEFV
• Alt name: pyrin
• Species: H. sapiens (human)
• Mutation: M694V Methionine 694 to valine (FMF mutation)
• Entrez Gene: MEFV (a.k.a. FMF, MEF, PAAND, TRIM20)
• Tag / Fusion Protein:
  • 3xFlag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not1 (not destroyed)
• 3′ cloning site: xho1 (not destroyed)
• 5′ sequencing primer: TAGTTACTTAAGCTCGGGCCCC

Resource Information

• Supplemental Documents:
  • Tentative3xFlag_M694V-MEFVinPentri.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry