pAAV-Syn1-FLEX-mCh-T2A-FLAG-hMOR-WPRE
(Plasmid #166970)

• Purpose: Cre-dependent viral expression of the human mu opioid receptor (hMOR/Oprm1) and mCherry. hMOR contains an N-terminal FLAG tag.
• Depositing Lab: Matthew Banghart
• Publication: Liu et al Proc Natl Acad Sci U S A. 2021 Jun 8;118(23). pii: 2022134118. doi: 10.1073/pnas.2022134118.

Backbone

• Vector backbone: pAAV-Syn1-FLEX-WPRE
• Backbone manufacturer: Vector Builder
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 6500
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Homo sapiens opioid receptor mu 1 (OPRM1)
• Alt name: hMOR
• Alt name: MOP
• Alt name: MOPR
• Species: H. sapiens (human)
• Insert Size (bp): 2004
• GenBank ID: NM_000914.5 Gene ID 4988
• Entrez Gene: OPRM1 (a.k.a. LMOR, M-OR-1, MOP, MOR, MOR1, OPRM)
• Promoter: hsyn
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • T2A (N terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: GCGTAAAAGGAGCAACATAGTTAAGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Vector Builder
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry