HyperADAR control
(Plasmid #166969)

• Purpose: Express the Hyperactive catalytic domain of Drosophila ADAR and linker at the 5' end of this domain, in the MSCV-IRES-GFP
• Depositing Lab: Michael Kharas
• Publication: Nguyen et al Nat Commun. 2020 Apr 24;11(1):2026. doi: 10.1038/s41467-020-15814-8.

Backbone

• Vector backbone: MSCV-IRES-GFP
• Backbone manufacturer: Addgene (with XhoI at 5' end and EcoRI at 3'end)
• Backbone size w/o insert (bp): 7362
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: linker-hyperADAR
• Insert Size (bp): 1260
• Promoter: MSCV
• Tag / Fusion Protein:
  • linker-HyperADAR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry