MSI2-DCD
(Plasmid
#166968)
-
PurposeExpress the fusion protein of human MSI2 and the catalytic dead domain of Drosophila ADAR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV-IRES-GFP
-
Backbone manufacturerAddgene (with XhoI at 5' end and EcoRI at 3'end)
- Backbone size w/o insert (bp) 7362
-
Modifications to backboneXhoI at 5' end and EcoRI at 3'end)
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMSI2-DCD
-
Insert Size (bp)2239
-
MutationN495S
- Promoter MSCV
-
Tag
/ Fusion Protein
- MSI2-DCD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSI2-DCD was a gift from Michael Kharas (Addgene plasmid # 166968 ; http://n2t.net/addgene:166968 ; RRID:Addgene_166968) -
For your References section:
HyperTRIBE uncovers increased MUSASHI-2 RNA binding activity and differential regulation in leukemic stem cells. Nguyen DTT, Lu Y, Chu KL, Yang X, Park SM, Choo ZN, Chin CR, Prieto C, Schurer A, Barin E, Savino AM, Gourkanti S, Patel P, Vu LP, Leslie CS, Kharas MG. Nat Commun. 2020 Apr 24;11(1):2026. doi: 10.1038/s41467-020-15814-8. 10.1038/s41467-020-15814-8 PubMed 32332729