Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSI2-ADA
(Plasmid #166967)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV-IRES-GFP
  • Backbone manufacturer
    Addgene (with XhoI at 5' end and EcoRI at 3'end)
  • Backbone size w/o insert (bp) 7362
  • Modifications to backbone
    XhoI at 5' end and EcoRI at 3'end
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MSI2-ADA
  • Insert Size (bp)
    2241
  • Promoter MSCV
  • Tag / Fusion Protein
    • MSI2-ADA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSI2-ADA was a gift from Michael Kharas (Addgene plasmid # 166967 ; http://n2t.net/addgene:166967 ; RRID:Addgene_166967)
  • For your References section:

    HyperTRIBE uncovers increased MUSASHI-2 RNA binding activity and differential regulation in leukemic stem cells. Nguyen DTT, Lu Y, Chu KL, Yang X, Park SM, Choo ZN, Chin CR, Prieto C, Schurer A, Barin E, Savino AM, Gourkanti S, Patel P, Vu LP, Leslie CS, Kharas MG. Nat Commun. 2020 Apr 24;11(1):2026. doi: 10.1038/s41467-020-15814-8. 10.1038/s41467-020-15814-8 PubMed 32332729