Skip to main content
Addgene

pLV-EF1a-GFP-SFPQ-IRES-mCherry
(Plasmid #166950)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166950 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-eF1a-IRES::mcherry
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SFPQ
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2841
  • Entrez Gene
    SFPQ (a.k.a. POMP100, PPP1R140, PSF)
  • Promoter eF1a
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer eF1a Intron: CATGTGACTCCACGGAGTACC
  • 3′ sequencing primer M13
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-EF1a-GFP-SFPQ-IRES-mCherry was a gift from Rosalind Segal (Addgene plasmid # 166950 ; http://n2t.net/addgene:166950 ; RRID:Addgene_166950)
  • For your References section:

    Binding and transport of SFPQ-RNA granules by KIF5A/KLC1 motors promotes axon survival. Fukuda Y, Pazyra-Murphy MF, Silagi ES, Tasdemir-Yilmaz OE, Li Y, Rose L, Yeoh ZC, Vangos NE, Geffken EA, Seo HS, Adelmant G, Bird GH, Walensky LD, Marto JA, Dhe-Paganon S, Segal RA. J Cell Biol. 2021 Jan 4;220(1). pii: 211577. doi: 10.1083/jcb.202005051. 10.1083/jcb.202005051 PubMed 33284322