pLV-EF1a-GFP-SFPQ-IRES-mCherry
(Plasmid
#166950)
-
PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-eF1a-IRES::mcherry
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSFPQ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2841
-
Entrez GeneSFPQ (a.k.a. POMP100, PPP1R140, PSF)
- Promoter eF1a
-
Tags
/ Fusion Proteins
- GFP (N terminal on insert)
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer eF1a Intron: CATGTGACTCCACGGAGTACC
- 3′ sequencing primer M13 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-EF1a-GFP-SFPQ-IRES-mCherry was a gift from Rosalind Segal (Addgene plasmid # 166950 ; http://n2t.net/addgene:166950 ; RRID:Addgene_166950) -
For your References section:
Binding and transport of SFPQ-RNA granules by KIF5A/KLC1 motors promotes axon survival. Fukuda Y, Pazyra-Murphy MF, Silagi ES, Tasdemir-Yilmaz OE, Li Y, Rose L, Yeoh ZC, Vangos NE, Geffken EA, Seo HS, Adelmant G, Bird GH, Walensky LD, Marto JA, Dhe-Paganon S, Segal RA. J Cell Biol. 2021 Jan 4;220(1). pii: 211577. doi: 10.1083/jcb.202005051. 10.1083/jcb.202005051 PubMed 33284322