Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-EF1a-HaloSFPQY527A
(Plasmid #166949)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166949 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-eF1a
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SFPQ-Y527A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3027
  • Mutation
    SFPQ-Y527A
  • Entrez Gene
    SFPQ (a.k.a. POMP100, PPP1R140, PSF)
  • Promoter eF1a
  • Tag / Fusion Protein
    • Halo (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer eF1a Intron: CATGTGACTCCACGGAGTACC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-EF1a-HaloSFPQY527A was a gift from Rosalind Segal (Addgene plasmid # 166949 ; http://n2t.net/addgene:166949 ; RRID:Addgene_166949)
  • For your References section:

    Binding and transport of SFPQ-RNA granules by KIF5A/KLC1 motors promotes axon survival. Fukuda Y, Pazyra-Murphy MF, Silagi ES, Tasdemir-Yilmaz OE, Li Y, Rose L, Yeoh ZC, Vangos NE, Geffken EA, Seo HS, Adelmant G, Bird GH, Walensky LD, Marto JA, Dhe-Paganon S, Segal RA. J Cell Biol. 2021 Jan 4;220(1). pii: 211577. doi: 10.1083/jcb.202005051. 10.1083/jcb.202005051 PubMed 33284322