pET-28a_6H-MMLV_RT_D524N-6H
(Plasmid #166945)

• Purpose: Bacterial expression of M-MLV reverse transcriptase
• Depositing Lab: Robert Tjian
• Publication: Graham et al PLoS One. 2021 Feb 3;16(2):e0246647. doi: 10.1371/journal.pone.0246647. eCollection 2021.

Backbone

• Vector backbone: pET-28a(+)
• Backbone manufacturer: Novagen (EMD Millipore)
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 7306
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Rosetta (DE3) strain for protein expression
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gag-pol
• Alt name: M-MLV Reverse Transcriptase
• Alt name: Pr180
• Species: Moloney murine leukemia virus
• Insert Size (bp): 2100
• Mutation: D524N, H8Y
• GenBank ID: 2193424 AAC82568
• Promoter: T7
• Tags / Fusion Proteins:
  • 6X His (N terminal on backbone)
  • 6X His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: TAGTTATTGCTCAGCGGTGG

Resource Information

• Supplemental Documents:
  • pET-28a_6H-MMLV_RT_D524N-6H.gb
• A portion of this plasmid was derived from a plasmid made by: This plasmid was found in our lab stocks. Its original source in not known.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry