Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-TRE-FH-TET3 short
(Plasmid #166916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti CMVtight Neo DEST (w770-1) addgene 26432
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 13138
  • Modifications to backbone
    First, full length TET3 (PCR-ed from addgene plasmid 49446) was inserted using Gateway cloning. Second, a SalI - FseI fragment (synthesized as gBlock, IDT) was inserted into the SalI FseI sites to create the 5’ changes unique to TET3 short.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TET3 short isoform
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5175
  • Mutation
    Changed nucleotide 18 (G) to (A) to delete FseI restriction site. This mutation does not affect the amino acid identity.
  • GenBank ID
    NM_001366022.1
  • Tag / Fusion Protein
    • HA Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-TRE-FH-TET3 short was a gift from Roland Friedel (Addgene plasmid # 166916 ; http://n2t.net/addgene:166916 ; RRID:Addgene_166916)
  • For your References section:

    Circadian clock regulator Bmal1 gates axon regeneration via Tet3 epigenetics in mouse sensory neurons. Halawani D, Wang Y, Ramakrishnan A, Estill M, He X, Shen L, Friedel RH, Zou H. Nat Commun. 2023 Aug 24;14(1):5165. doi: 10.1038/s41467-023-40816-7. 10.1038/s41467-023-40816-7 PubMed 37620297
Commonly requested with: