pLKO-Tet-On-ARNT-shRNA2
(Plasmid
#166911)
-
PurposeLentivirus for inducible knockdown of human ARNT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO-TET-ON-addgene#21915
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 9000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARNT shRNA
-
Alt nameARNT
-
gRNA/shRNA sequenceGCCTACACTCTCCAACACAAT
-
SpeciesH. sapiens (human)
-
Entrez GeneARNT (a.k.a. ARNT1, HIF-1-beta, HIF-1beta, HIF1-beta, HIF1B, HIF1BETA, TANGO, bHLHe2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer pLKO-seq: ggcagggatattcaccattatcgtttcaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Tet-On-ARNT-shRNA2 was a gift from Roland Friedel (Addgene plasmid # 166911 ; http://n2t.net/addgene:166911 ; RRID:Addgene_166911)