Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pM116: CasRx VEGFA presgRNA
(Plasmid #166868)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166868 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pXR004: CasRx pre-gRNA cloning backbone
  • Backbone manufacturer
    Plasmid #109054
  • Backbone size w/o insert (bp) 2927
  • Total vector size (bp) 2957
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human VEGFA targeting presgRNA
  • gRNA/shRNA sequence
    TATGTGCTGGCCTTGGTGAGGTTTGATCCG
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer CTCCTTTCGCTTTCTTCCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM116: CasRx VEGFA presgRNA was a gift from Guei-Sheung Liu (Addgene plasmid # 166868 ; http://n2t.net/addgene:166868 ; RRID:Addgene_166868)
  • For your References section:

    Methods for in vitro CRISPR/CasRx-Mediated RNA Editing. Chuang YF, Wang PY, Kumar S, Lama S, Lin FL, Liu GS. Front Cell Dev Biol. 2021 Jun 11;9:667879. doi: 10.3389/fcell.2021.667879. eCollection 2021. 10.3389/fcell.2021.667879 PubMed 34178991