pIA1385
(Plasmid #166862)

• Purpose: Codon optimized SARS-CoV-2 Nsp12 gene was cloned into a modified pRSFDuet-1 vector (Addgene #159107) for expression in E. coli.
• Depositing Lab: Irina Artsimovitch
• Publication: Wang et al mBio. 2021 Jun 29;12(3):e0142321. doi: 10.1128/mBio.01423-21. Epub 2021 Jun 22.

Backbone

• Vector backbone: pRSFDuet-1
• Total vector size (bp): 6721
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SARS-COV-2 Nsp12
• Species: Synthetic
• Insert Size (bp): 2821
• GenBank ID:
• Entrez Gene: ORF1ab (a.k.a. GU280_gp01)
• Promoter: T7
• Tag / Fusion Protein:
  • His-SUMO (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pIA1385.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry