pcDNA3.1-SARS2-Spike-D614G
(Plasmid
#166850)
-
PurposeFor expression of SARS-CoV-2 Spike D614G in mammalian cells (C9 tagged at C-term)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike
-
Alt namespike glycoprotein
-
SpeciesSARS-CoV-2 virus
-
Insert Size (bp)3819
-
GenBank ID43740568
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- C9 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer ccagaatagaatgacacctac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-SARS2-Spike-D614G was a gift from Neville Sanjana (Addgene plasmid # 166850 ; http://n2t.net/addgene:166850 ; RRID:Addgene_166850) -
For your References section:
The Spike D614G mutation increases SARS-CoV-2 infection of multiple human cell types. Daniloski Z, Jordan TX, Ilmain JK, Guo X, Bhabha G, tenOever BR, Sanjana NE. Elife. 2021 Feb 11;10. pii: 65365. doi: 10.7554/eLife.65365. 10.7554/eLife.65365 PubMed 33570490