Venus-79aa-ActA-pEGFP-C1
(Plasmid #166763)

• Purpose: To target Venus to the mitochondrial outer membrane. ActA tail anchor inserts into the outer membrane and Venus faces the cytosol. Serves as a collisional control in FLIM-FRET experiments.
• Depositing Lab: David Andrews
• Publication: Andrew lab Venus and Cerulean fusions (unpublished)

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ActA tail anchor (Listeria monocytogenes)
• Alt name: Venus-ActA, V-ActA
• Species: Synthetic; Listeria monocytogenes
• Entrez Gene: actA (a.k.a. lmo0204)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-79aa-ActA-pEGFP-C1.gb
• A portion of this plasmid was derived from a plasmid made by: See gene entry for "actin assembly-inducing protein ActA" (NCBI Reference Sequence: WP_110138194.1). Here we have used only the C-terminal tail anchor sequence of this protein.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

"SGLRSRGSGLRSRAQASNSAVDARGSGLRSRAQASNSAVDARGSGLRSRAQASNSAVDAR
GSGLRSRAQASNSAVDARV" amino acid targeting sequence, which we refer to as "ActA", for the mitochondrial outer membrane. Pearson's correlation of 0.8-0.9 with mitotracker red signal in cells. "79aa" indicates the 79 amino acid flexible linker region between Venus and the ActA targeting signal.