Venus-BimEL(Noxa)-pEGFP-C1
(Plasmid #166761)

• Purpose: To examine effect of swapping the BH3 region in full length BimEL with that of Noxa
• Depositing Lab: David Andrews
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BimEL(Mus musculus)-(Noxa BH3)
• Alt name: BimEL-Noxa, BimEL(Noxa BH3), VBimEL(Noxa), VBimEL(Noxa BH3)
• Species: H. sapiens (human), M. musculus (mouse)
• Mutation: BH3 region removed and inserted BH3 of human Noxa protein
• Entrez Gene: Bcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
• Entrez Gene: PMAIP1 (a.k.a. APR, NOXA)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-BimEL(Noxa)-pEGFP-C3.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

BH3 region removed and inserted BH3 of Noxa protein. There is a K107E mutation in the Venus sequence of this plasmid. The K107E mutation is facing outwards in the B-Barrel structure of the Venus protein. Therefore, it is unlikely that this mutation would affect the chromophore within the β-barrel. We have transfected this plasmid in BMK-DKO cells and did not observe aggregation. We also used this construct and observed Forster resonance energy transfer from mCerulean3 in the context of measuring interactions with two binding partners. Thus, this mutation does not appear to affect the Venus fluorophore.