Skip to main content
Addgene

His6-TEV-mCerulean3-pBluescript
(Plasmid #166757)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166757 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCerulean3
  • Species
    Synthetic
  • Promoter T7
  • Tag / Fusion Protein
    • 6x Histidine tag, and TEV protease site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCAATTAACCCTCACTAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid can be used to express mCerulean3 fluorophore in bacteria. We used E.coli BL21-AI (Arabinose induction) for protein production, induced 5h at 30oC. Purify protein via Nickel column chromatography. When compared with mCerulean, the mCerulean3 fluorophore contains the following mutations: T66S, S146H, D147G, K167G, I168L, R169N and H170C.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His6-TEV-mCerulean3-pBluescript was a gift from David Andrews (Addgene plasmid # 166757 ; http://n2t.net/addgene:166757 ; RRID:Addgene_166757)
  • For your References section:

    Efficacy and specificity of inhibitors of BCL-2 family protein interactions assessed by affinity measurements in live cells. Osterlund EJ, Hirmiz N, Pemberton JM, Nougarede A, Liu Q, Leber B, Fang Q, Andrews DW. Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20. 10.1126/sciadv.abm7375 PubMed 35442739