mCerulean3-Mcl-1-pLVX
(Plasmid
#166752)
-
PurposeExpress mCerulean3 fused to the N-terminus of Bcl-2 family protein, Mcl-1, in a plasmid compatable for lentiviral infection. Used to make stable BMK-DKO cell lines.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166752 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMcl-1
-
Alt nameBcl2 like protein 3 (Bcl2l3), Induced myeloid leukemia cell differentiation protein Mcl-1
-
SpeciesH. sapiens (human)
-
Entrez GeneMCL1 (a.k.a. BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean3 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. Mcl-1 sequence aligns with Homo sapiens MCL1 apoptosis regulator, BCL2 family member (MCL1), transcript variant 1, mRNA(NCBI Reference Sequence: NM_021960.5). The pLVX backbone from Addgene #115969 (Adrein Nougarede & David Andrews) was used and mCerulean3-Mcl1 was inserted.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2nd generation lentiviral transfer plasmid that can be used to create lentivirus, for CMV driven expression of mCerulean3 fused to the N-terminus of Mcl-1. There is a flexible, 17 amino acid linker between mCerulean3 and Mcl-1. proteins.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCerulean3-Mcl-1-pLVX was a gift from David Andrews (Addgene plasmid # 166752 ; http://n2t.net/addgene:166752 ; RRID:Addgene_166752) -
For your References section:
Efficacy and specificity of inhibitors of BCL-2 family protein interactions assessed by affinity measurements in live cells. Osterlund EJ, Hirmiz N, Pemberton JM, Nougarede A, Liu Q, Leber B, Fang Q, Andrews DW. Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20. 10.1126/sciadv.abm7375 PubMed 35442739