mCerulean3-Mcl-1-pLVX
(Plasmid #166752)

• Purpose: Express mCerulean3 fused to the N-terminus of Bcl-2 family protein, Mcl-1, in a plasmid compatable for lentiviral infection. Used to make stable BMK-DKO cell lines.
• Depositing Lab: David Andrews
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pLVX
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mcl-1
• Alt name: Bcl2 like protein 3 (Bcl2l3), Induced myeloid leukemia cell differentiation protein Mcl-1
• Species: H. sapiens (human)
• Entrez Gene: MCL1 (a.k.a. BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCerulean3 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: CAGCGGGGCTGCTAAAGCGCATGC

Resource Information

• Supplemental Documents:
  • mCer3-Mcl-1-pLVX.gb
• A portion of this plasmid was derived from a plasmid made by: mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. Mcl-1 sequence aligns with Homo sapiens MCL1 apoptosis regulator, BCL2 family member (MCL1), transcript variant 1, mRNA(NCBI Reference Sequence: NM_021960.5). The pLVX backbone from Addgene #115969 (Adrein Nougarede & David Andrews) was used and mCerulean3-Mcl1 was inserted.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

2nd generation lentiviral transfer plasmid that can be used to create lentivirus, for CMV driven expression of mCerulean3 fused to the N-terminus of Mcl-1. There is a flexible, 17 amino acid linker between mCerulean3 and Mcl-1. proteins.