Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mCerulean3-Bcl-2-s2193
(Plasmid #166750)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166750 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    s2193
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bcl-2
  • Species
    H. sapiens (human)
  • Entrez Gene
    BCL2 (a.k.a. Bcl-2, PPP1R50)
  • Promoter Human ferritin
  • Tag / Fusion Protein
    • mCerulean3 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
  • 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. Bcl2 sequence aligns with Genebank accession # M14745.1 of human Bcl2, Homo sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-2. There is a flexible, 7 amino acid linker between "SGLRSTR", between mCerulean3 and Bcl-2. Selection with Blasticidin was used to generate BMK-DKO cells stably expressing this plasmid. Expression under control of Human ferritin promoter. Glysine 237 of Bcl-2 is mutated to Serine, with no effect on anti-apoptotic function.

Please note coding region of Bcl-2 is from human DNA described in 1994 (Janiak et al., 1994) published in JBC. There is a M157I mutation in this Bcl-2 sequence. This mutation was in the original clone and has been used to inhibit apoptosis by our group and many others around the world since that time. It has always been our assumption that this mutation is a naturally occurring variant. Our clone has been used in many publications as the plasmid was widely distributed when it was first assembled and published. Janiak F, Leber B, Andrews DW. Assembly of Bcl-2 into microsomal and outer mitochondrial membranes. J Biol Chem. 1994 Apr 1;269(13):9842-9. PMID: 8144576.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCerulean3-Bcl-2-s2193 was a gift from David Andrews (Addgene plasmid # 166750 ; http://n2t.net/addgene:166750 ; RRID:Addgene_166750)
  • For your References section:

    Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026