mCerulean3-Bcl-2-s2193
(Plasmid #166750)

• Purpose: Express mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bcl-2 in a plasmid with Blasticidin resistance. Used to make stable BMK-DKO cell lines.
• Depositing Lab: David Andrews
• Publication: Liu et al Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689.

Backbone

• Vector backbone: s2193
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Blasticidin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Bcl-2
• Species: H. sapiens (human)
• Entrez Gene: BCL2 (a.k.a. Bcl-2, PPP1R50)
• Promoter: Human ferritin
• Tag / Fusion Protein:
  • mCerulean3 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: CCTTGAGTTTTGAGCGGAGCTAA
• 3′ sequencing primer: TTACCCCTCTAGACCTGGAAAG

Resource Information

• Supplemental Documents:
  • mCerulean3-Bcl2-s2193.gb
• A portion of this plasmid was derived from a plasmid made by: mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. Bcl2 sequence aligns with Genebank accession # M14745.1 of human Bcl2, Homo sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-2. There is a flexible, 7 amino acid linker between "SGLRSTR", between mCerulean3 and Bcl-2. Selection with Blasticidin was used to generate BMK-DKO cells stably expressing this plasmid. Expression under control of Human ferritin promoter. Glysine 237 of Bcl-2 is mutated to Serine, with no effect on anti-apoptotic function.

Please note coding region of Bcl-2 is from human DNA described in 1994 (Janiak et al., 1994) published in JBC. There is a M157I mutation in this Bcl-2 sequence. This mutation was in the original clone and has been used to inhibit apoptosis by our group and many others around the world since that time. It has always been our assumption that this mutation is a naturally occurring variant. Our clone has been used in many publications as the plasmid was widely distributed when it was first assembled and published. Janiak F, Leber B, Andrews DW. Assembly of Bcl-2 into microsomal and outer mitochondrial membranes. J Biol Chem. 1994 Apr 1;269(13):9842-9. PMID: 8144576.