Venus-tBid-4E-pEGFP-C1
(Plasmid #166743)

• Purpose: Express Venus fused to the N-terminus of the Bcl-2 family protein, tBid with mutation in BH3 domain to disrupt binding anti-apoptotic proteins
• Depositing Lab: David Andrews
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tBid-4E
• Alt name: p15 fragment of BH3-interacting domain death agonist protein, or Bcl2 like protein 10 (BCL2L10)
• Species: M. musculus (mouse)
• Mutation: 4 hydrophobic residues in the BH3 region mutated to glutamic acid: I27E, L31E, I34E, M38E.
• Entrez Gene: Bid (a.k.a. 2700049M22Rik)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-tBid-4E-pEGFP-C3.gb
• A portion of this plasmid was derived from a plasmid made by: tBid seqence aligns with Mus musculus BH3 interacting domain death agonist (Bid), mRNA; NCBI Reference Sequence: NM_007544.4.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express "VtBid-4E" (Venus fused to the N-terminus of the BH3-only protein, truncated Bid (tBid)) in live cells. In cells, caspase 8 cleavage of Bid produces the p15 fragment, referred to as tBid. BH3 region has hydrophobic positions H1-H4 mutated to glutamic acid (E). BH3, Mutations: I27E, L31E, I34E, M38E. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.