Venus-Bad-4E-pEGFP-C1
(Plasmid #166740)

• Purpose: Express Venus fused to the N-terminus of the Bcl-2 family protein, Bad with mutation in BH3 domain to disrupt binding anti-apoptotic proteins
• Depositing Lab: David Andrews
• Publication: Liu et al Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bad-4E
• Alt name: Bcl2 associated agonist of cell death, or Bcl2 like protein 8 (BCL2L8)
• Species: H. sapiens (human)
• Mutation: 4 hydrophobic residues in the BH3 region mutated to glutamic acid: Y110E, L114E, M117E, F122E.
• Entrez Gene: BAD (a.k.a. BBC2, BCL2L8)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Bad-4E-pEGFP-C3.gb
• A portion of this plasmid was derived from a plasmid made by: Bad sequence aligns with Homo sapiens BAD mRNA for BCL2-antagonist of cell death protein (GenBank accession #: AB451254.1)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express "VBad-4E" (Venus fused to the N-terminus of the BH3-only protein, Bad-4E) in live cells. There is a flexible, 7 amino acid linker between Venus and Bad-4E proteins. Full length Bad protein with BH3 region hydrophobic positions H1-H4 mutated to glutamic acid (E), refered to as "BH3-4E" mutation, BH3 mutations: Y110E, L114E, M117E, F122E. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.