Venus-Puma-pEGFP-C1
(Plasmid #166739)

• Purpose: Express Venus fused to the N-terminus of the Bcl-2 family protein, Puma
• Depositing Lab: David Andrews
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Puma
• Alt name: p53 up-regulated modulator of apoptosis, or Bcl-2-binding component 3, alpha isoform
• Species: H. sapiens (human)
• Entrez Gene: BBC3 (a.k.a. JFY-1, JFY1, PUMA)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Puma-pEGFP-C3.gb
• A portion of this plasmid was derived from a plasmid made by: Puma sequence aligns with bcl-2-binding component 3 (BBC3), isoform 4 [Homo sapiens] (NCBI Reference Sequence: NP_055232.1).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express "VPuma" (Venus fused to the N-terminus of the BH3-only protein, Puma) in live cells. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric. In cloning, the last amino acid of Venus protein was deleted (K239S). Result is a 1 amino acid linker between Venus and Puma proteins. The encoded BBC3 isoform 4 is also known as PUMA-alpha.