Venus-Noxa-pEGFP-C1
(Plasmid #166738)

• Purpose: Express Venus fused to the N-terminus of the Bcl-2 family protein, Noxa
• Depositing Lab: David Andrews
• Publication: Osterlund et al Sci Adv. 2022 Apr 22;8(16):eabm7375. doi: 10.1126/sciadv.abm7375. Epub 2022 Apr 20.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Noxa
• Alt name: PMA-induced protein 1
• Species: H. sapiens (human)
• Entrez Gene: PMAIP1 (a.k.a. APR, NOXA)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-Noxa-pEGFP-C1.gb
• A portion of this plasmid was derived from a plasmid made by: Noxa sequence aligns with phorbol-12-myristate-13-acetate-induced protein 1 isoform 6 [Homo sapiens] (NCBI Reference Sequence: NM_021127.3)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express "VNoxa" (Venus fused to the N-terminus of the BH3-only protein, Noxa) in live cells. There is an 8 amino acid flexible linker between Venus and Noxa proteins. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an A207K, F224R and L232H mutations to make it monomeric.