Venus-BimL-pEGFP-C1
(Plasmid #166734)

• Purpose: Express Venus fused to the N-terminus of the Bcl-2 family protein, BimL
• Depositing Lab: David Andrews
• Publication: Liu et al Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689.

Backbone

• Vector backbone: pEGFP-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BimL
• Alt name: Bcl2 like protein 11 (BCL2L11), isoform BimL
• Species: M. musculus (mouse)
• Entrez Gene: Bcl2l11 (a.k.a. 1500006F24Rik, Bim, Bod, bcl2-L-11)
• Promoter: CMV
• Tag / Fusion Protein:
  • Venus (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTAGG
• 3′ sequencing primer: TCGCCCTTTGACGTTGGAGTCCAC

Resource Information

• Supplemental Documents:
  • Venus-BimL-pEGFP- C3.gb
• A portion of this plasmid was derived from a plasmid made by: BimL sequence aligns with Mus musculus BCL2-like 11 (apoptosis facilitator) (Bcl2l11), transcript variant 2, mRNA NCBI Reference Sequence: NM_207681.2.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express "VBimL" (Venus fused to the N-terminus of the BH3-only protein, BimL) in live cells. There is a 3 amino acid flexible linker between Venus and BimL proteins. When compared with EYFP, Venus fluorophore contains the following mutations: F46L, F64L, M153T, V163A and S175G. This Venus protein contains an F224R mutation to make it monomeric.