Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCSN074
(Plasmid #166731)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166731 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS414
  • Backbone size w/o insert (bp) 7206
  • Total vector size (bp) 10926
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    TRP1 ; KanMX

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas12a-NLS
  • Alt name
    dCpf1-NLS
  • Species
    Synthetic; Lachnospiraceae bacterium ND2006
  • Insert Size (bp)
    3720
  • Mutation
    E925A
  • Promoter S. cerevisiae TEF1
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGTCTAAGTTGGAAAAATTCACCA
  • 3′ sequencing primer TTATACCTTTCTCTTCTTCTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSN074 was a gift from Rene Verwaal (Addgene plasmid # 166731 ; http://n2t.net/addgene:166731 ; RRID:Addgene_166731)
  • For your References section:

    Efficient multiplexed gene regulation in Saccharomyces cerevisiae using dCas12a. Ciurkot K, Gorochowski TE, Roubos JA, Verwaal R. Nucleic Acids Res. 2021 Jul 1. pii: 6312738. doi: 10.1093/nar/gkab529. 10.1093/nar/gkab529 PubMed 34197613