pGMC00004
(Plasmid
#166721)
-
PurposesgRNA against mouse Kitl
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX458
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKitl
-
gRNA/shRNA sequenceCCTCAACTATGTCGCCGGGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneKitl (a.k.a. Clo, Con, Gb, Kitlg, Mgf, SCF, SF, SLF, Sl, blz, contrasted)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMC00004 was a gift from Raj Chari (Addgene plasmid # 166721 ; http://n2t.net/addgene:166721 ; RRID:Addgene_166721) -
For your References section:
Tumour-elicited neutrophils engage mitochondrial metabolism to circumvent nutrient limitations and maintain immune suppression. Rice CM, Davies LC, Subleski JJ, Maio N, Gonzalez-Cotto M, Andrews C, Patel NL, Palmieri EM, Weiss JM, Lee JM, Annunziata CM, Rouault TA, Durum SK, McVicar DW. Nat Commun. 2018 Nov 30;9(1):5099. doi: 10.1038/s41467-018-07505-2. 10.1038/s41467-018-07505-2 PubMed 30504842