Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGMC00004
(Plasmid #166721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX458
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kitl
  • gRNA/shRNA sequence
    CCTCAACTATGTCGCCGGGA
  • Species
    M. musculus (mouse)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00004 was a gift from Raj Chari (Addgene plasmid # 166721 ; http://n2t.net/addgene:166721 ; RRID:Addgene_166721)
  • For your References section:

    Tumour-elicited neutrophils engage mitochondrial metabolism to circumvent nutrient limitations and maintain immune suppression. Rice CM, Davies LC, Subleski JJ, Maio N, Gonzalez-Cotto M, Andrews C, Patel NL, Palmieri EM, Weiss JM, Lee JM, Annunziata CM, Rouault TA, Durum SK, McVicar DW. Nat Commun. 2018 Nov 30;9(1):5099. doi: 10.1038/s41467-018-07505-2. 10.1038/s41467-018-07505-2 PubMed 30504842