Skip to main content
Addgene

pLenti-CMV-Puro-miniAAVR-FLAG
(Plasmid #166717)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166717 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-CMV-Puro-DEST
  • Backbone manufacturer
    addgene plasmid #17452
  • Backbone size w/o insert (bp) 9628
  • Total vector size (bp) 9331
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miniAAVR-FLAG
  • Alt name
    KIAA0319L (PKD1-3)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1410
  • Mutation
    Only expressing PKD1-3 of ectodomain
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gactctagtccagtgtggtg
  • 3′ sequencing primer atccagaggttgattgtcgag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-Puro-miniAAVR-FLAG was a gift from Jan Carette (Addgene plasmid # 166717 ; http://n2t.net/addgene:166717 ; RRID:Addgene_166717)
  • For your References section:

    An essential receptor for adeno-associated virus infection. Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, Jae LT, Wosen JE, Nagamine CM, Chapman MS, Carette JE. Nature. 2016 Feb 4;530(7588):108-12. doi: 10.1038/nature16465. Epub 2016 Jan 27. 10.1038/nature16465 PubMed 26814968