pLenti-CMV-Puro-miniAAVR-FLAG
(Plasmid
#166717)
-
PurposeVector expressing a minimal AAVR (KIAA0319L) construct PKD1-3 with a C-terminal Flag tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti-CMV-Puro-DEST
-
Backbone manufactureraddgene plasmid #17452
- Backbone size w/o insert (bp) 9628
- Total vector size (bp) 9331
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameminiAAVR-FLAG
-
Alt nameKIAA0319L (PKD1-3)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1410
-
MutationOnly expressing PKD1-3 of ectodomain
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gactctagtccagtgtggtg
- 3′ sequencing primer atccagaggttgattgtcgag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-Puro-miniAAVR-FLAG was a gift from Jan Carette (Addgene plasmid # 166717 ; http://n2t.net/addgene:166717 ; RRID:Addgene_166717) -
For your References section:
An essential receptor for adeno-associated virus infection. Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, Jae LT, Wosen JE, Nagamine CM, Chapman MS, Carette JE. Nature. 2016 Feb 4;530(7588):108-12. doi: 10.1038/nature16465. Epub 2016 Jan 27. 10.1038/nature16465 PubMed 26814968