pcDNA3HA-AMOT p130∆PPxY1
(Plasmid #166711)

• Purpose: expresses AMOT with inactivating mutation in first PPxY motif in mammalian cells
• Depositing Lab: Wesley Sundquist
• Publication: Rheinemann et al J Biol Chem. 2021 Jul 17:100975. doi: 10.1016/j.jbc.2021.100975.

Backbone

• Vector backbone: pcDNA
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 8701
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Angiomotin p130 L129A P130A
• Species: H. sapiens (human)
• Insert Size (bp): 3255
• Mutation: changed leucine 129 to alanine, proline 130 to alanine
• Promoter: CMV promoter
• Tag / Fusion Protein:
  • 2xHA (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTAATACGACTCACTATAGGG
• 3′ sequencing primer: AACTAGAAGGCACAGTCGAGGCTG

Resource Information

• Supplemental Documents:
  • pCDNA-AMOTp130(L129A P130A).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry