pLSB-KAN
(Plasmid #166700)

• Purpose: Combined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.
• Depositing Lab: Robin Allshire
• Publication: Torres-Garcia et al Wellcome Open Res. 2020 Nov 24;5:274. doi: 10.12688/wellcomeopenres.16405.1. eCollection 2020.

Backbone

• Vector backbone: pLSB
• Backbone size w/o insert (bp): 5225
• Total vector size (bp): 11782
• Vector type: Yeast Expression
• Selectable markers: G418 (kanMX6)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: tRNA promoter : sgRNA cassette
• Species: S. pombe (fission yeast)
• Insert Size (bp): 1393
• Promoter: tRNA Ser promoter

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtaaaacgacggccagt
• 3′ sequencing primer: gtggaattgtgagcggataa

Gene/Insert 2

• Gene/Insert name: adh15 promoter : Cas9 codon-optimised for S. pombe
• Species: Streptococcus pyogenes
• Insert Size (bp): 5164
• Promoter: adh15 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCGCCCTCCTATTGGCTTC

Resource Information

• Supplemental Documents:
  • pLSB-KAN.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The following acknowledgement must be included in all research publications and other outputs: “pLSB-KAN was created with the support of the Wellcome Trust [095021], [200885], [203149]”.

The following statement must be included on all submissions of original research to peer-reviewed journals: “pLSB-KAN was created with the support of the Wellcome Trust [095021], [200885], [203149]”.