pAAV-RHO-IntC-dCas9C-VPR-polyA
(Plasmid #166692)

• Purpose: Express C-terminal part of split dCas9-VPR
• Depositing Lab: Stylianos Michalakis
• Publication: Bohm et al Sci Adv. 2020 Aug 19;6(34):eaba5614. doi: 10.1126/sciadv.aba5614. eCollection 2020 Aug.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 3530
• Total vector size (bp): 7343
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: IntC-dCas9C-VPR
• Species: Streptococcus pygenes
• Insert Size (bp): 3820
• Promoter: short human rhodopsin promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGGGGGGTCAGAACCCAGAG
• 3′ sequencing primer: AATTCGCCCTTAACTCGAGA

Resource Information

• Supplemental Documents:
  • pAAV-RHO-IntC-dCas9C-VPR-polyA.gbk
• A portion of this plasmid was derived from a plasmid made by: pAAV-CMV-Cas9C-VPR, Addgene plasmid 80933
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry