mCherry-GAL9
(Plasmid #166689)

• Purpose: For creating a stable mCherry-GAL9 cell line
• Depositing Lab: Alan Sabirsh
• Publication: Munson et al Commun Biol. 2021 Feb 16;4(1):211. doi: 10.1038/s42003-021-01728-8.

Backbone

• Vector backbone: AAVS1 Donor Plasmid
• Backbone size w/o insert (bp): 4712
• Total vector size (bp): 6499
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LGALS9
• Alt name: LGALS9A
• Species: H. sapiens (human)
• Insert Size (bp): 1787
• GenBank ID: NM_009587
• Entrez Gene: LGALS9 (a.k.a. HUAT, LGALS9A)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry