Skip to main content
Addgene

pLV-U6-UL29-U3-UL8
(Plasmid #166685)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166685 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCCL-PGK-egfp
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UL8 and UL29 gRNA
  • gRNA/shRNA sequence
    UL29 gRNA gcgagcgtacacgtatccc; UL8 gRNA ggggcagccataccgcgtaa
  • Species
    HSV-1
  • Entrez Gene
    UL29 (a.k.a. HHV1gp00p46)
  • Entrez Gene
    UL8 (a.k.a. HHV1gp00p67)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-U6-UL29-U3-UL8 was a gift from Yujia Cai (Addgene plasmid # 166685 ; http://n2t.net/addgene:166685 ; RRID:Addgene_166685)
  • For your References section:

    Targeting herpes simplex virus with CRISPR-Cas9 cures herpetic stromal keratitis in mice. Yin D, Ling S, Wang D, Dai Y, Jiang H, Zhou X, Paludan SR, Hong J, Cai Y. Nat Biotechnol. 2021 Jan 11. pii: 10.1038/s41587-020-00781-8. doi: 10.1038/s41587-020-00781-8. 10.1038/s41587-020-00781-8 PubMed 33432198