deltaVP1 + VP2C-GFP
(Plasmid
#166676)
-
PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepILGFPB5A
-
Vector typeYeast Expression, Synthetic Biology
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVP2C-GFP
-
Alt nameVP2C-yEGFP
-
Alt nameMurine polyomavirus VP2(251-301)-GFP
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Murine polyomavirus
-
Insert Size (bp)927
- Promoter GAL10
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTAATGCCATGTAATATGATTATTAAAC
- 3′ sequencing primer GCATTGGCACGGTGCAACAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMurine polyomavirus deltaVP1 (NLS deletion mutant)
-
Alt nameMPyV deltaVP1
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Murine polyomavirus
-
Insert Size (bp)1143
- Promoter GAL1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTTCTTATTCAAATGTCATAAAAGTATCAAC
- 3′ sequencing primer CCAGCCTGCTTTTCTGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.30.428974v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
deltaVP1 + VP2C-GFP was a gift from Claudia Vickers (Addgene plasmid # 166676 ; http://n2t.net/addgene:166676 ; RRID:Addgene_166676) -
For your References section:
Artificial Self-assembling Nanocompartment for Organizing Metabolic Pathways in Yeast. Cheah LC, Stark T, Adamson LSR, Abidin RS, Lau YH, Sainsbury F, Vickers CE. ACS Synth Biol. 2021 Dec 17;10(12):3251-3263. doi: 10.1021/acssynbio.1c00045. Epub 2021 Sep 30. 10.1021/acssynbio.1c00045 PubMed 34591448