Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

deltaVP1 only
(Plasmid #166675)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166675 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pILGFPB5A
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Murine polyomavirus deltaVP1 (NLS deletion mutant)
  • Alt name
    MPyV deltaVP1
  • Species
    S. cerevisiae (budding yeast), Synthetic; Murine polyomavirus
  • Insert Size (bp)
    1143
  • Promoter GAL1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTTCTTATTCAAATGTCATAAAAGTATCAAC
  • 3′ sequencing primer CCAGCCTGCTTTTCTGTAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    deltaVP1 only was a gift from Claudia Vickers (Addgene plasmid # 166675 ; http://n2t.net/addgene:166675 ; RRID:Addgene_166675)
  • For your References section:

    Artificial Self-assembling Nanocompartment for Organizing Metabolic Pathways in Yeast. Cheah LC, Stark T, Adamson LSR, Abidin RS, Lau YH, Sainsbury F, Vickers CE. ACS Synth Biol. 2021 Dec 17;10(12):3251-3263. doi: 10.1021/acssynbio.1c00045. Epub 2021 Sep 30. 10.1021/acssynbio.1c00045 PubMed 34591448