WT-β3
(Plasmid #166579)

• Purpose: For expression of cytoplasmic tail of mouse beta3 integrin with N-terminal GST fusion protein in bacterial cells.
• Depositing Lab: Vesa Hytönen
• Publication: Zhang et al Proc Natl Acad Sci U S A. 2020 Dec 22;117(51):32402-32412. doi: 10.1073/pnas.2014583117. Epub 2020 Dec 7.

Backbone

• Vector backbone: pGEX-2T
• Backbone manufacturer: SnapGene
• Backbone size w/o insert (bp): 4948
• Total vector size (bp): 5791
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use BL21-Star (DE3), or other suitable strain for expression. 37C for 5h protein production after induction
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: β3
• Species: M. musculus (mouse)
• Insert Size (bp): 843
• Entrez Gene: Itgb3 (a.k.a. CD61, GP3A, INGRB3)
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: pGEX 5’ Sequencing Primer 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
• 3′ sequencing primer: pGEX 3’ Sequencing Primer 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry