Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

WT-β3
(Plasmid #166579)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-2T
  • Backbone manufacturer
    SnapGene
  • Backbone size w/o insert (bp) 4948
  • Total vector size (bp) 5791
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use BL21-Star (DE3), or other suitable strain for expression. 37C for 5h protein production after induction
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    β3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    843
  • Entrez Gene
    Itgb3 (a.k.a. CD61, GP3A, INGRB3)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pGEX 5’ Sequencing Primer 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • 3′ sequencing primer pGEX 3’ Sequencing Primer 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WT-β3 was a gift from Vesa Hytönen (Addgene plasmid # 166579 ; http://n2t.net/addgene:166579 ; RRID:Addgene_166579)
  • For your References section:

    Crystal structure of the FERM-folded talin head reveals the determinants for integrin binding. Zhang P, Azizi L, Kukkurainen S, Gao T, Baikoghli M, Jacquier MC, Sun Y, Maatta JAE, Cheng RH, Wehrle-Haller B, Hytonen VP, Wu J. Proc Natl Acad Sci U S A. 2020 Dec 22;117(51):32402-32412. doi: 10.1073/pnas.2014583117. Epub 2020 Dec 7. 10.1073/pnas.2014583117 PubMed 33288722