pWZL N-Myc-hPOT1_deltaOB
(Plasmid #166408)

• Purpose: express hPOT1 ΔOB in mammalian cells
• Depositing Lab: Agnel Sfeir
• Publication: Pinzaru et al Genes Dev. 2020 Dec 1;34(23-24):1619-1636. doi: 10.1101/gad.337287.120. Epub 2020 Oct 29.

Backbone

• Vector backbone: pWZL N-MYC
• Backbone size w/o insert (bp): 5665
• Total vector size (bp): 7189
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: POT1 ΔOB
• Alt name: POT1
• Alt name: CMM10, GLM9, HPOT1
• Species: H. sapiens (human)
• Insert Size (bp): 1525
• Mutation: ΔOB
• Entrez Gene: POT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
• Tag / Fusion Protein:
  • myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CCTTTGTACACCCTAAGCCT
• 3′ sequencing primer: AATGCTCGTCAAGAAGAC

Resource Information

• Supplemental Documents:
  • pWZL N-Myc-hPOT1_deltaOB-IRES_hygro.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry