pAUX_OL
(Plasmid
#166246)
-
Purposeuse as an auxiliary temperature-sensitive plasmid to successfully transform pdCas9_CL plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKD46
- Total vector size (bp) 3212
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsThis plasmid can be cured by growth at 37C because it has temperature-sensitive replicon.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name[P112-sgRNA-term]-[J23116_B34-dCas9-B15]
-
Insert Size (bp)4618
- Promoter Ec-TTL-P112 and BBa_J23116
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer catcgatttatgccacctgacgtc
- 3′ sequencing primer tataaacgcagaaaggcccacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAUX_OL was a gift from Domitilla Del Vecchio (Addgene plasmid # 166246 ; http://n2t.net/addgene:166246 ; RRID:Addgene_166246) -
For your References section:
dCas9 regulator to neutralize competition in CRISPRi circuits. Huang HH, Bellato M, Qian Y, Cardenas P, Pasotti L, Magni P, Del Vecchio D. Nat Commun. 2021 Mar 16;12(1):1692. doi: 10.1038/s41467-021-21772-6. 10.1038/s41467-021-21772-6 PubMed 33727557