Skip to main content
Addgene

pdCas9_CL
(Plasmid #166245)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BBa_J107202
  • Total vector size (bp) 2603
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    To successfully obtain the bacterial transformants of this plasmid, it required to use pAUX_OL plasmid.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P112-sgRNA-term-P104-RBS1-dCas9-B15
  • Insert Size (bp)
    4574
  • Promoter Ec-TTL-P112 and Ec-TTL-P104

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGCGCCAAAAAGAGTATTG
  • 3′ sequencing primer tataaacgcagaaaggcccacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdCas9_CL was a gift from Domitilla Del Vecchio (Addgene plasmid # 166245 ; http://n2t.net/addgene:166245 ; RRID:Addgene_166245)
  • For your References section:

    dCas9 regulator to neutralize competition in CRISPRi circuits. Huang HH, Bellato M, Qian Y, Cardenas P, Pasotti L, Magni P, Del Vecchio D. Nat Commun. 2021 Mar 16;12(1):1692. doi: 10.1038/s41467-021-21772-6. 10.1038/s41467-021-21772-6 PubMed 33727557