Skip to main content
Addgene

lentiCRISPR v2 puro - CRBN (#2)
(Plasmid #166241)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166241 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone size w/o insert (bp) 14877
  • Total vector size (bp) 14895
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRBN
  • gRNA/shRNA sequence
    GCAGGACGCTGCGCACAACA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_016302
  • Entrez Gene
    CRBN (a.k.a. MRT2, MRT2A)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2 puro - CRBN (#2) was a gift from Günter Schneider (Addgene plasmid # 166241 ; http://n2t.net/addgene:166241 ; RRID:Addgene_166241)

  • For your References section:

    A novel Cereblon E3 ligase modulator with antitumor activity in gastrointestinal cancer. Lier S, Sellmer A, Orben F, Heinzlmeir S, Krauss L, Schneeweis C, Hassan Z, Schneider C, Schafer A, Pongratz H, Engleitner T, Ollinger R, Kuisl A, Bassermann F, Schlag C, Kong B, Dove S, Kuster B, Rad R, Reichert M, Wirth M, Saur D, Mahboobi S, Schneider G. Bioorg Chem. 2021 Nov 20:105505. doi: 10.1016/j.bioorg.2021.105505. 10.1016/j.bioorg.2021.105505 PubMed 34838332
Related items:
Commonly requested with: