pcDNA3.1-rsAKARev(T/A)
(Plasmid
#166232)
-
PurposeExpresses reversibly switchable A-kinase activity reporter with EV-linker inactive T/A mutant (rsAKARev(T/A)) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5399
- Total vector size (bp) 7676
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReversibly switchable A-kinase activity reporter with EV-linker inactive T/A mutant
-
Alt namersAKARev(T/A)
-
Insert Size (bp)2277
-
Mutationchanged Threonine 506 in rsAKARev to Alanine
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pre-print of this article is available on BioRxiv.org
doi: https://doi.org/10.1101/2021.01.06.425528
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-rsAKARev(T/A) was a gift from Peter Dedecker (Addgene plasmid # 166232 ; http://n2t.net/addgene:166232 ; RRID:Addgene_166232) -
For your References section:
Simultaneous readout of multiple FRET pairs using photochromism. Roebroek T, Vandenberg W, Sipieter F, Hugelier S, Stove C, Zhang J, Dedecker P. Nat Commun. 2021 Mar 31;12(1):2005. doi: 10.1038/s41467-021-22043-0. 10.1038/s41467-021-22043-0 PubMed 33790271