pLV-CS-154
(Plasmid
#166230)
-
Purposelenti-U6-gRNA::CMVp-nCas9-PmCDA1-UGI-2A-mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166230 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLVSIN-CMV-Pur
-
Backbone manufacturerTaKaRa
- Backbone size w/o insert (bp) 5819
- Total vector size (bp) 12971
-
Vector typeLentiviral, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6-gRNA EGFP targetting
-
SpeciesSynthetic
- Promoter Human U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namenCas9-PmCDA1-UGI-2A-mCherry
-
SpeciesSynthetic
- Promoter CMV promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-CS-154 was a gift from Nozomu Yachie (Addgene plasmid # 166230 ; http://n2t.net/addgene:166230 ; RRID:Addgene_166230) -
For your References section:
CRISPR/Cas9-mediated base-editing enables a chain reaction through sequential repair of sgRNA scaffold mutations. Fukushima T, Tanaka Y, Adachi K, Masuyama N, Tsuchiya A, Asada S, Ishiguro S, Mori H, Seki M, Yachie N, Goyama S, Kitamura T. Sci Rep. 2021 Dec 13;11(1):23889. doi: 10.1038/s41598-021-02986-6. 10.1038/s41598-021-02986-6 PubMed 34903756