pLenti-mCherry-CAAX
(Plasmid #166229)

• Purpose: Lentiviral plasmid for expression of mCherry with a C-terminal CAAX polybasic sequence from KRras targeting mCherry to the plasma membrane.
• Depositing Lab: Carlos Carmona-Fontaine
• Publication: Janska et al Dis Model Mech. 2021 Aug 1;14(8). pii: 271783. doi: 10.1242/dmm.048942. Epub 2021 Aug 18.

Backbone

• Vector backbone: LV 1-5
• Backbone size w/o insert (bp): 6468
• Total vector size (bp): 7226
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-CAAX
• Species: Synthetic
• Insert Size (bp): 758
• Promoter: CMV
• Tag / Fusion Protein:
  • CAAX (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACAGTGCAGGGGAAAGAATAGT
• 3′ sequencing primer: ACAAGGAGGAGAAAATGAAAGCC

Resource Information

• Supplemental Documents:
  • pLenti-mCherry-CAAX.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry