Skip to main content
Addgene

pLenti-mCherry-CAAX
(Plasmid #166229)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166229 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LV 1-5
  • Backbone size w/o insert (bp) 6468
  • Total vector size (bp) 7226
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-CAAX
  • Species
    Synthetic
  • Insert Size (bp)
    758
  • Promoter CMV
  • Tag / Fusion Protein
    • CAAX (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAGTGCAGGGGAAAGAATAGT
  • 3′ sequencing primer ACAAGGAGGAGAAAATGAAAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-mCherry-CAAX was a gift from Carlos Carmona-Fontaine (Addgene plasmid # 166229 ; http://n2t.net/addgene:166229 ; RRID:Addgene_166229)
  • For your References section:

    The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment. Janska L, Anandi L, Kirchberger NC, Marinkovic ZS, Schachtner LT, Guzelsoy G, Carmona-Fontaine C. Dis Model Mech. 2021 Aug 1;14(8). pii: 271783. doi: 10.1242/dmm.048942. Epub 2021 Aug 18. 10.1242/dmm.048942 PubMed 34407185