Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV hSYN DIO mGluR1-myc-FLAG
(Plasmid #166227)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166227 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4869
  • Total vector size (bp) 7682
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    metabotropic glutamate receptor 1
  • Alt name
    mGluR1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2808
  • GenBank ID
    NM_001114333
  • Entrez Gene
    Grm1 (a.k.a. 4930455H15Rik, Gm10828, Gprc1a, mGluR1, nmf373, rcw, wobl)
  • Promoter human Synapsin
  • Tag / Fusion Protein
    • Myc and FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcaccacgcgaggcgcgagat
  • 3′ sequencing primer caaccaggatttatacaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original cDNA from origene (CAT: MR211136)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV hSYN DIO mGluR1-myc-FLAG was a gift from Jason Aoto (Addgene plasmid # 166227 ; http://n2t.net/addgene:166227 ; RRID:Addgene_166227)
  • For your References section:

    Loss of nigral excitation of cholinergic interneurons contributes to parkinsonian motor impairments. Cai Y, Nielsen BE, Boxer EE, Aoto J, Ford CP. Neuron. 2021 Apr 7;109(7):1137-1149.e5. doi: 10.1016/j.neuron.2021.01.028. Epub 2021 Feb 17. 10.1016/j.neuron.2021.01.028 PubMed 33600762