AAV hSYN DIO mGluR1-myc-FLAG
(Plasmid
#166227)
-
PurposeAAV expressing cre-dependent mGluR1-myc-FLAG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4869
- Total vector size (bp) 7682
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemetabotropic glutamate receptor 1
-
Alt namemGluR1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2808
-
GenBank IDNM_001114333
-
Entrez GeneGrm1 (a.k.a. 4930455H15Rik, Gm10828, Gprc1a, mGluR1, nmf373, rcw, wobl)
- Promoter human Synapsin
-
Tag
/ Fusion Protein
- Myc and FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaccacgcgaggcgcgagat
- 3′ sequencing primer caaccaggatttatacaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOrigene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original cDNA from origene (CAT: MR211136)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV hSYN DIO mGluR1-myc-FLAG was a gift from Jason Aoto (Addgene plasmid # 166227 ; http://n2t.net/addgene:166227 ; RRID:Addgene_166227) -
For your References section:
Loss of nigral excitation of cholinergic interneurons contributes to parkinsonian motor impairments. Cai Y, Nielsen BE, Boxer EE, Aoto J, Ford CP. Neuron. 2021 Apr 7;109(7):1137-1149.e5. doi: 10.1016/j.neuron.2021.01.028. Epub 2021 Feb 17. 10.1016/j.neuron.2021.01.028 PubMed 33600762