Skip to main content
Addgene

pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
(Plasmid #166133)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166133 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti spCas9 T2A iRFP670 P2A puro
  • Backbone manufacturer
    Addgene #122182
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin, Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hU6-gRNA and hH1-gRNA targeting cldn1 gene
  • gRNA/shRNA sequence
    gagcgagtcatggccaacgc and caacagctgcagccccgcgt
  • Species
    H. sapiens (human)
  • GenBank ID
    9076 NG_021418
  • Tag / Fusion Protein
    • iRFP670 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer gggtttattacagggacagcagag
  • 3′ sequencing primer ggagccaattcccactcctttc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro was a gift from Raphael Gaudin (Addgene plasmid # 166133 ; http://n2t.net/addgene:166133 ; RRID:Addgene_166133)

  • For your References section:

    Occludin stalls HCV particle dynamics apart from hepatocyte tight junctions, promoting virion internalization. Deffieu MS, Clement CMH, Dorobantu CM, Partiot E, Bare Y, Faklaris O, Riviere B, Ayala-Nunez NV, Baumert TF, Ronde P, Mely Y, Lucansky V, Gaudin R. Hepatology. 2022 Apr 7. doi: 10.1002/hep.32514. 10.1002/hep.32514 PubMed 35388524
Related items: