HCP9
(Plasmid
#166111)
-
PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Hta2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYTK102
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHta2-sg18
-
gRNA/shRNA sequenceTTGAGAAGCTTTGGCAGTCT
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneHTA2 (a.k.a. YBL003C, H2A2)
Cloning Information
- Cloning method Gateway Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HCP9 was a gift from Matthias Heinemann (Addgene plasmid # 166111 ; http://n2t.net/addgene:166111 ; RRID:Addgene_166111)