HCP1
(Plasmid
#166103)
-
PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepYTK101
-
Vector typeYeast Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMsn2-sgRNA#27
-
gRNA/shRNA sequenceATCAAGACTCATAAAAAACA
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneMSN2 (a.k.a. YMR037C)
Cloning Information
- Cloning method Gateway Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HCP1 was a gift from Matthias Heinemann (Addgene plasmid # 166103 ; http://n2t.net/addgene:166103 ; RRID:Addgene_166103)
