Skip to main content
Addgene

pROS13_IDH1 #4
(Plasmid #166101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166101 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pROS13
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IDH1 sgRNA #4
  • gRNA/shRNA sequence
    AAGCAAACAGATCATAAGGA
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    IDH1 (a.k.a. YNL037C)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pROS13_IDH1 #4 was a gift from Matthias Heinemann (Addgene plasmid # 166101 ; http://n2t.net/addgene:166101 ; RRID:Addgene_166101)
  • For your References section:

    A photo-switchable yeast isocitrate dehydrogenase to control metabolic flux through the citric acid cycle. Chen H, Mulder L, Wijma HJ, Wabeke R, Vila Cha Losa JP, Rovetta M, de Leeuw TC, Milias-Argeitis A, Heinemann M. bioRxiv 10.1101/2021.05.25.445643