pNSU299_RPL22A
(Plasmid
#166079)
-
PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS414
-
Backbone manufacturerSmith JD et al 2016. PMID 26956608
-
Vector typeYeast Expression, CRISPR
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter of RPL22A
-
gRNA/shRNA sequenceTTCAAAAGAGAAGCGCACTG
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneRPL22A (a.k.a. YLR061W)
- Promoter Tet-inducible
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJim Haber/Neal Sugawara
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA Binding Coordinates: chrXII:263006..263025 (- strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome.
Addgene QC identified discrepancies compared to the theoretical sequence. The depositing lab confirms the functional activity of the construct despite these differences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNSU299_RPL22A was a gift from Rebecca Burgess (Addgene plasmid # 166079 ; http://n2t.net/addgene:166079 ; RRID:Addgene_166079)